SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


ribosomal protein
10.99 kDa
protein length
gene length
285 bp Sequence Blast
ribosomal protein S6 (BS9)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal proteins]
  • Gene

    4,199,445 → 4,199,732

    The protein

    Protein family

  • [SW|ribosomal protein] S6P family (according to Swiss-Prot)
  • Structure

  • [PDB|3R3T] (from ''Bacillus anthracis'', 71% identity, 97% similarity)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24310371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab



  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    Biological materials


  • BKE40910 (Δ[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • BKK40910 (Δ[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • References

  • 19653700,14762004,11948165,11948146,23002217,22383849,24310371,15378759,25903689