SubtiBank SubtiBank
rpsF
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

rpsF

ribosomal protein
locus
BSU40910
pI
4.99
mw
10.99 kDa
protein length
gene length
285 bp Sequence Blast
function
translation
product
ribosomal protein S6 (BS9)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    4,199,445 → 4,199,732

    The protein

    Protein family

  • [SW|ribosomal protein] S6P family (according to Swiss-Prot)
  • Structure

  • [PDB|3R3T] (from ''Bacillus anthracis'', 71% identity, 97% similarity)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|14762004]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24310371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    genes
    [gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|24310371,22383849]

    regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    Biological materials

    Mutant

  • BKE40910 (Δ[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • BKK40910 (Δ[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • References

  • 19653700,14762004,11948165,11948146,23002217,22383849,24310371,15378759,25903689