SubtiBank SubtiBank
rpsF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpsF

ribosomal protein
locus
BSU_40910
pI
4.99
mw
10.99 kDa
protein length
gene length
288 bp Sequence Blast
function
translation
product
ribosomal protein S6 (BS9)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    4,199,445 4,199,732

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bS6 family (single member, according to UniProt)
  • Structure

  • [PDB|3R3T] (from ''Bacillus anthracis'', 71% identity, 97% similarity)
  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|BD162A17E5F3F9AB49E478CE72D0FE92D82E6673|yyzM]-[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]-[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|14762004]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24310371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    genes
    [gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|24310371,22383849]

    regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    Biological materials

    Mutant

  • BKE40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • BKK40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
  • References

  • 19653700,14762004,11948165,11948146,23002217,22383849,24310371,15378759,25903689