SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


9.97 kDa
protein length
gene length
267 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    536,404 536,670

    Expression and Regulation



    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE04890 ([gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTGATGTTCCCCCTTTA, downstream forward: _UP4_TACGAATAAGGGGTGAAAAT
  • BKK04890 ([gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTGATGTTCCCCCTTTA, downstream forward: _UP4_TACGAATAAGGGGTGAAAAT
  • References

  • 27766092