SubtiBank SubtiBank
spoIIIAE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIIAE

component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] type III secretion system residing in the forespore membrane, required for [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activation
locus
BSU_24390
pI
6.59
mw
43.68 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
product
component of a type III secretion system
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,534,326 2,535,525

    The protein

    [SW|Localization]

  • membrane protein [Pubmed|18485064], insertion into the membrane requires [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|SpoIIIJ] [Pubmed|18485064]
  • Expression and Regulation

    Operons

    genes
    [gene|70408C17CF8681998F7FD933D4BFF71D052626D9|yqhV]-[gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
    description
    [Pubmed|1766372]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]
  • view in new tab

    genes
    [gene|5FE74F270B28A404BFE0DAA4EB243009EEDEACF0|spoIIIAA]-[gene|D20198968665D3726839B2DC7F0638614319B853|spoIIIAB]-[gene|5CDBE6E299C7E6606D3C52E509CFED6F41F1E3F8|spoIIIAC]-[gene|576E36DA79F1ED097D649C35C5B59622FF1CFEF3|spoIIIAD]-[gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]-[gene|8A8C67AB955660FA41039B45F60A5B9F7B57704E|spoIIIAF]-[gene|5456B0C27EAE89F5B9E750D65E1E3C6EDA27C9FA|spoIIIAG]-[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]
    description
    [Pubmed|18485064]

    regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [http://www.ncbi.nlm.nih.gov/sites/entrez/17693505 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE24390 ([gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCAATCTACCGCCTCCTT, downstream forward: _UP4_ATGATGAAATGAAGGAGGCA
  • BKK24390 ([gene|9D4AE9AE191BFA82791549852782DC1B959A6897|spoIIIAE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCAATCTACCGCCTCCTT, downstream forward: _UP4_ATGATGAAATGAAGGAGGCA
  • labs

  • [SW|Richard Losick], Harvard University, Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • References

    Reviews

  • 31350897
  • Original Publications

  • 1766372,18485064,18820020,19609349