SubtiBank SubtiBank
ybxB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybxB

unknown
locus
BSU_01060
pI
6.12
mw
22.37 kDa
protein length
201 aa Sequence Blast
gene length
606 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybaA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    121,068 121,673

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|1DUS] (from Methanococcus jannaschii, 43% identity) [pubmed|12836702]
  • Expression and Regulation

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE01060 ([gene|9DA4AF1DBA4EA40F4E23B716EA81AC5B275BD7F5|ybxB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTAGAACCTCCTTTT, downstream forward: _UP4_TGACTCGGTATTTTAACTAT
  • BKK01060 ([gene|9DA4AF1DBA4EA40F4E23B716EA81AC5B275BD7F5|ybxB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTAGAACCTCCTTTT, downstream forward: _UP4_TGACTCGGTATTTTAACTAT
  • References

  • 7657605,26883633,12836702