SubtiBank SubtiBank
ybeF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybeF

unknown
locus
BSU_02150
pI
7.89
mw
9.02 kDa
protein length
gene length
249 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    235,625 235,873

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]-[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B973 (ybeF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1972 NBRP B. subtilis, Japan]
  • BKE02150 ([gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTAAACAGCCTCCCT, downstream forward: _UP4_TAAAAAGACCTCACTTTCTA
  • BKK02150 ([gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTAAACAGCCTCCCT, downstream forward: _UP4_TAAAAAGACCTCACTTTCTA