SubtiBank SubtiBank
yhcO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhcO

unknown
locus
BSU_09165
pI
5.43
mw
37.00 kDa
protein length
322 aa Sequence Blast
gene length
969 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    989,712 990,680

    Expression and Regulation

    Operons

    genes
    [gene|9DF4E223C4BAC30D70DC8146DEE20F0FD821611B|yhcO]
    description
    [Pubmed|15383836]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation [Pubmed|15699190,15383836]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • MGNA-A678 (yhcO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/678 NBRP B. subtilis, Japan]
  • BKE09165 ([gene|9DF4E223C4BAC30D70DC8146DEE20F0FD821611B|yhcO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09165 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGTCTCCCTCCCTGAG, downstream forward: _UP4_GTTATTAGTGAAGTCCTTGC
  • BKK09165 ([gene|9DF4E223C4BAC30D70DC8146DEE20F0FD821611B|yhcO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09165 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGTCTCCCTCCCTGAG, downstream forward: _UP4_GTTATTAGTGAAGTCCTTGC
  • References

  • 15699190,15383836,30782632