SubtiBank SubtiBank
ctaE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ctaE

cytochrome-c oxidase (subunit III)
locus
BSU_14910
pI
7.41
mw
23.12 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
respiration
product
cytochrome-c oxidase (subunit III)
essential
no
ec
1.9.3.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,563,437 1,564,060

    The protein

    Catalyzed reaction/ biological activity

  • 4 [Fe(II)cytochrome c] + 4 H+ + O2 --> 4 [Fe(III)cytochrome c] + 2 H2O (according to UniProt)
  • Protein family

  • cytochrome c oxidase subunit 3 family (with [protein|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|QoxC], according to UniProt)
  • Structure

  • [PDB|1FFT] (ubichinol oxidase from E. coli, 43% identity) [pubmed|11017202]
  • [SW|Localization]

  • cell membrane [Pubmed|23880299]
  • Expression and Regulation

    Operons

    genes
    [gene|83F5D5FCCAFADB7231ACD9BE7941820240954C70|ctaB]-[gene|72D5442C0EF3B404F7B615366E357B68C863CEB6|ctaC]-[gene|20D1174554A03EECE233A1A045F6DF83AF799959|ctaD]-[gene|9DF8423F1D63ED3928B2818F58BC3DECCDBB1DDB|ctaE]-[gene|28E5AF86CE49D7B0ECBFAF9ED5C1FC65D9F810EA|ctaF]-[gene|8C16E115CB59A74C24954BFCDE112720BA09D5EA|ctaG]
    description
    [Pubmed|9829923]

    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|9829923], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|9829923]
  • view in new tab

    Biological materials

    Mutant

  • BKE14910 ([gene|9DF8423F1D63ED3928B2818F58BC3DECCDBB1DDB|ctaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTGAATTTTTCTTGAACTT, downstream forward: _UP4_TTAATGGGGATGGTGGGATA
  • BKK14910 ([gene|9DF8423F1D63ED3928B2818F58BC3DECCDBB1DDB|ctaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTGAATTTTTCTTGAACTT, downstream forward: _UP4_TTAATGGGGATGGTGGGATA
  • References

  • 10551842,9829923,20817675,23880299,27503613,11017202