SubtiBank SubtiBank
cgeD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cgeD

maturation of the outermost layer of the spore
locus
BSU_19760
pI
7.19
mw
49.91 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
maturation of the outermost layer of the spore
product
unknown
essential
no
synonyms
cgeBB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,146,821 2,148,101

    The protein

    Paralogous protein(s)

  • [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|SpsA]: the N-terminal 220 aa of [protein|9EDE093896E8535962903D7A202D69C1BC402C09|CgeD] and [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|SpsA]: 45.5% identity
  • Structure

  • [PDB|1QG8] (the N-terminal domain, [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|SpsA], 46% identity) [pubmed|10350455]
  • Expression and Regulation

    Operons

    genes
    [gene|6C7778EFFADDF522E2DBC32219D83E7CBCF2BED0|cgeC]-[gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]-[gene|11966AE70567D707D546C4A2F12B2DEAE95A1883|cgeE]
    description
    [Pubmed|7592393]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials

    Mutant

  • BKE19760 ([gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATACCGCCTCCCGCC, downstream forward: _UP4_TAAAGGTATAGGTCATAAAA
  • BKK19760 ([gene|9EDE093896E8535962903D7A202D69C1BC402C09|cgeD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATACCGCCTCCCGCC, downstream forward: _UP4_TAAAGGTATAGGTCATAAAA
  • References

  • 7592393,15699190,26577401,10350455