SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD] operons
21.61 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
regulation of choline uptake
transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    3,471,266 3,471,823

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional repression of the ''[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]'' and ''[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]'' operons [Pubmed|23960087]
  • Protein family

  • GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV], according to UniProt)
  • Paralogous protein(s)

  • [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 28-79) (according to InterPro)
  • Expression and Regulation




  • upregulated in response to salt stress [Pubmed|32849357]
  • view in new tab

    Biological materials


  • MGNA-A458 (yvbF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • BKK33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • References

  • 23960087,32849357