SubtiBank SubtiBank
yfjR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfjR

similar to 3-hydroxyisobutyrate dehydrogenase
locus
BSU_07990
pI
4.78
mw
27.72 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
unknown
product
3-hydroxyisobutyrate dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    870,388 871,248

    The protein

    Protein family

  • HIBADH-related family (with [protein|1010B1028A9A5F234C33474C7BC23C9BD2ABF3C4|YkwC], according to UniProt)
  • Paralogous protein(s)

  • [protein|1010B1028A9A5F234C33474C7BC23C9BD2ABF3C4|YkwC]:
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|4GBJ] (from ''Dyadobacter Fermentans'', 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9F8A63C585227D59C8A5CD4356E3F81EB5897131|yfjR]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C350 (yfjR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2348 NBRP B. subtilis, Japan]
  • BKE07990 ([gene|9F8A63C585227D59C8A5CD4356E3F81EB5897131|yfjR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTAATCACTCCCTGAA, downstream forward: _UP4_TAAAGAAAAGCCTCTCCGTT
  • BKK07990 ([gene|9F8A63C585227D59C8A5CD4356E3F81EB5897131|yfjR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTAATCACTCCCTGAA, downstream forward: _UP4_TAAAGAAAAGCCTCTCCGTT
  • References

  • 16493705,20512483