SubtiBank SubtiBank
thyB [2019-08-05 13:06:46]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

thyB [2019-08-05 13:06:46]

thymidylate synthase B
30.39 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
biosynthesis of thymidine nucleotides
thymidylate synthase B

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,297,106 2,297,900

    The protein

    Catalyzed reaction/ biological activity

  • 5,10-methylenetetrahydrofolate dUMP = dihydrofolate dTMP (according to Swiss-Prot)
  • Protein family

  • thymidylate synthase family (with [protein|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|ThyA], according to UniProt)
  • Paralogous protein(s)

  • [protein|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|ThyA]
  • Modification

  • phosphorylated on Arg-102 [Pubmed|22517742]
  • Structure

  • [PDB|3IX6] (from ''Brucella melitensis'', 67% identity)
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: activation, weak, in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • weak induction in the presence of glucose ([protein|search|CcpN]) [Pubmed|19732150]
  • view in new tab

    Biological materials


  • BKE21820 ([gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTAAA, downstream forward: _UP4_GTATGATTTCATTCATTTTT
  • BKK21820 ([gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTAAA, downstream forward: _UP4_GTATGATTTCATTCATTTTT
  • References


  • 7574499
  • Original publications

  • 418407,19732150,2840350,22517742,29150519