SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


2-oxoisovalerate dehydrogenase (E1 beta subunit)
35.70 kDa
protein length
327 aa Sequence Blast
gene length
984 bp Sequence Blast
utilization of branched-chain keto acids
2-oxoisovalerate dehydrogenase (E1 beta subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,498,093 2,499,076

    The protein

    Catalyzed reaction/ biological activity

  • 3-methyl-2-oxobutanoate + [dihydrolipoyllysine-residue (2-methylpropanoyl)transferase]-(R)-N6-lipoyl-L-lysine + H+ --> [dihydrolipoyllysine-residue (2-methylpropanoyl)transferase]-(R)-N6-(S8-2-methylpropanoyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
  • Paralogous protein(s)

  • [protein|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|PdhB], [protein|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|AcoB]
  • Structure

  • [PDB|3DUF] (Geobacillus stearothermophilus [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], 36% identity) [pubmed|19081062]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials


  • MGNA-C437 (bfmBAB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24040 ([gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTGACATTTGTTCTT, downstream forward: _UP4_TAAAGACGTAAGGGAGGATA
  • BKK24040 ([gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACTGACATTTGTTCTT, downstream forward: _UP4_TAAAGACGTAAGGGAGGATA
  • References

  • 12427936,15241682,10094682,12823818,16479537,1886522,19081062