SubtiBank SubtiBank
yabA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yabA

inhibitor of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] oligomerization, tethers [protein|search|DnaA ]to the polymerase-clamp protein [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN]
locus
BSU_00330
pI
6.07
mw
13.96 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
positioning of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]
product
negative regulator of [category|SW 3.1.1|replication] initiation
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    42,499 42,858

    Phenotypes of a mutant

  • strongly reduced growth rate in minimal medium [Pubmed|12060778]
  • over-initiation of [category|SW 3.1.1|replication] [pubmed|15927750]
  • a [gene|search|whiA ][gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA] double mutant is not viable [pubmed|29378890]
  • The protein

    Catalyzed reaction/ biological activity

  • negative control of replication initiation [Pubmed|12060778]
  • associates with the ''oriC'' region in a [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]-dependent manner, this limits the amount of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] that can bind the ''oriC'' region [Pubmed|21895792]
  • YabA inhibits co-operative DNA binding by [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|21895792]
  • inhibits oligomerization and helix formation of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|23909787]
  • Protein family

  • YabA family (single member, according to UniProt)
  • [SW|Domains]

  • leucine zipper
  • Modification

  • phosphorylated on Thr-71 by [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|YabT] [pubmed|29619013]
  • [SW|Cofactors]

  • Zinc [Pubmed|26615189]
  • Effectors of protein activity

  • [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN] overexpression or release from the replisome decreases association of [protein|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|YabA] with ''oriC'', increases association of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] with ''oriC'' [Pubmed|21895792]
  • Structure

  • [PDB|5DOL] [Pubmed|26615189]
  • [SW|Localization]

  • forms foci in the midcell region, this depends on the interaction with [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] and [protein|83E05071DEC874248D3E96B8F3A093C65939B314|DnaN] [Pubmed|26615189]
  • co-localizes with the origin region and replication forks throughout the cell cycle [pubmed|28166228]
  • Expression and Regulation

    Operons

    genes
    [gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    genes
    [gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B900 (yabA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1899 NBRP B. subtilis, Japan]
  • BKE00330 ([gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATCCAAGGTTCCACACC, downstream forward: _UP4_TAGGGAAAAGGCTTCCGCAT
  • BKK00330 ([gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATCCAAGGTTCCACACC, downstream forward: _UP4_TAGGGAAAAGGCTTCCGCAT
  • labs

  • [SW|Philippe Noirot], Jouy-en-Josas, France [http://locus.jouy.inra.fr/cms/index.php?id=18 Homepage]
  • [SW|Alan Grossman], Cambridge, MA, USA [http://web.mit.edu/biology/www/facultyareas/facresearch/grossman.html Homepage]
  • References

    Reviews

  • 20157337,28075389
  • Original publications

  • 19578359,21895792,12060778,16461910,19737352,19081080,23909787,22383849,26615189,28166228,15927750,29378890,29619013,30285297