SubtiBank SubtiBank
ybaS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybaS

similar to Na+-dependent transporter
locus
BSU_01590
pI
10.18
mw
30.46 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    178,665 179,585

    The protein

    Structure

  • [PDB|4N7W] (from Yersinia frederiksenii, 25% identity) [pubmed|24317697]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • BKK01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • References

    Research papers

  • 24317697