SubtiBank SubtiBank
uxuA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

uxuA

D-mannonate hydrolyase
locus
BSU_12340
pI
4.92
mw
40.87 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
hexuronate utilization
product
D-mannonate hydrolyase
essential
no
ec
4.2.1.8
synonyms
yjmE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,305,486 1,306,565

    The protein

    Catalyzed reaction/ biological activity

  • D-mannonate --> 2-dehydro-3-deoxy-D-gluconate + H2O (according to UniProt)
  • Protein family

  • mannonate dehydratase family (single member, according to UniProt)
  • Structure

  • [PDB|1TZ9] (from Enterococcus faecalis, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A369 (yjmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/369 NBRP B. subtilis, Japan]
  • BKE12340 ([gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCGCACCTCCGGATT, downstream forward: _UP4_ATGGCAAAAAAAGAGGTGGG
  • BKK12340 ([gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCGCACCTCCGGATT, downstream forward: _UP4_ATGGCAAAAAAAGAGGTGGG
  • References

  • 9579062,9579062,9882655,10666464