SubtiBank SubtiBank
conB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

conB

part of the ICEBs1 conjugation machinery, required for the localization of ConE to the membrane
locus
BSU_04910
pI
7.02
mw
41.25 kDa
protein length
354 aa Sequence Blast
gene length
1065 bp Sequence Blast
function
conjugative transfer of ICEBs1
product
part of the ICEBs1 conjugation machinery
essential
no
synonyms
yddB

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    536,985 538,049

    The protein

    [SW|Localization]

  • cell membrane, integral membrane protein [Pubmed|26013486]
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials

    Mutant

  • BKE04910 ([gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTGAGCAACTTTTTC, downstream forward: _UP4_AAACATCAATAGGAGGTTTA
  • BKK04910 ([gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATTGAGCAACTTTTTC, downstream forward: _UP4_AAACATCAATAGGAGGTTTA
  • References

  • 26013486