SubtiBank SubtiBank
ypgQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypgQ

Mn2+-dependent pyrophosphohydrolase, hydrolyzes (deoxy)ribonucleoside triphosphate [(d)NTP] to (deoxy)ribonucleoside monophosphate and pyrophosphate
locus
BSU_21890
pI
5.51
mw
22.98 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
degradation of excessive or abnormal nucleotides
product
Mn2+-dependent pyrophosphohydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • Gene

    Coordinates
    2,303,920 2,304,537

    The protein

    [SW|Domains]

  • [SW|HD domain] (aa 22 ... 138) [Pubmed|27062940]
  • [SW|Cofactors]

  • Mn2+ [Pubmed|27062940]
  • Structure

  • [PDB|5IHY] [Pubmed|27062940]
  • [PDB|5DQV] [Pubmed|27062940]
  • [PDB|5DQW] (complexed with ADP) [Pubmed|27062940]
  • Expression and Regulation

    Operons

    genes
    [gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]-[gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]-[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A888 (ypgQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/888 NBRP B. subtilis, Japan]
  • BKE21890 ([gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCACAAAAACACCCT, downstream forward: _UP4_TAATAGAAGGCTTGGAGCGA
  • BKK21890 ([gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTTCACAAAAACACCCT, downstream forward: _UP4_TAATAGAAGGCTTGGAGCGA
  • References

  • 25005104,27062940