SubtiBank SubtiBank
zur
The papers of the month are back! Check them out! Link here

zur

transcriptional repressor, regulates zinc homeostasis
locus
BSU25100
pI
4.86
mw
16.42 kDa
protein length
145 aa Sequence Blast
gene length
435 bp Sequence Blast
function
regulation of zinc homeostasis([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|yciC], [gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB])
product
transcriptional repressor ([SW|Fur family])
essential
no
synonyms
yqfV

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    2,591,428 → 2,591,865

    The protein

    Protein family

  • [SW|Fur family]
  • Paralogous protein(s)

  • [protein|D0982500E52577D52FADF775C0E512A4B9657B79|AhpC], [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur], [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the [SW|Zur regulon] [Pubmed|21821657]
  • zinc binding is negatively co-operative resulting in step-wise induction of the genes of the [SW|Zur regulon] upon zinc depletion [Pubmed|27561249]
  • [SW|Localization]

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000090 PRODORIC2 database]
  • Biological materials

    Mutant

  • 1A904 ( ''zur''::''spec''), [Pubmed|12029044], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A904&Search=1A904 BGSC]
  • BKE25100 (Δ[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • BKK25100 (Δ[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • Labs working on this gene/protein

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 21821657,18344368,14563870,12904577,16493705,9811636,12426338,19648245,25649915,27561249