SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor, regulates zinc homeostasis
16.42 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
regulation of zinc homeostasis([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA], [gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB])
transcriptional repressor ([SW|Fur family])

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,591,428 2,591,865

    The protein

    Protein family

  • [SW|Fur family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur], [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the [SW|Zur regulon] [Pubmed|21821657]
  • zinc binding is negatively co-operative resulting in step-wise induction of the genes of the [SW|Zur regulon] upon zinc depletion [Pubmed|27561249]
  • Structure

  • [PDB|2FE3] ([protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR], 35% identity) [pubmed|16925555]
  • [SW|Localization]

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    Biological materials


  • 1A904 ( ''zur''::''spec''), [Pubmed|12029044], available at [ BGSC]
  • BKE25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • BKK25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 21821657,18344368,14563870,12904577,16493705,9811636,12426338,19648245,25649915,27561249,16925555,31818924