SubtiBank SubtiBank
yxnB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxnB

unknown
locus
BSU_39910
pI
5.11
mw
18.90 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,098,423 4,098,905

    Expression and Regulation

    Operons

    genes
    [gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]
    description
    [Pubmed|20185509]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]-[gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]-[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B766 (yxnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1765 NBRP B. subtilis, Japan]
  • BKE39910 ([gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCACTTTTTGTTTTTCCA, downstream forward: _UP4_TAACGCTATTGGGAGGGAGA
  • BKK39910 ([gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCACTTTTTGTTTTTCCA, downstream forward: _UP4_TAACGCTATTGGGAGGGAGA
  • References

  • 10746760,12618455,10498721,20185509,12618455,15101989