SubtiBank SubtiBank
yycN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yycN

putative N-acetyltransferase
locus
BSU_40290
pI
6.83
mw
18.02 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,139,679 4,140,149

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|07A30814F57112196051289AA309AE6DB22CAEFF|YdgE]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 11-156) (according to UniProt)
  • Structure

  • [PDB|1UFH] [pubmed|14635137]
  • Expression and Regulation

    Operons

    genes
    [gene|A1B9CF581D2D73AC3D2E290E6B86AD63BE0544DE|yycN]
    description
    [pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B820 (yycN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1819 NBRP B. subtilis, Japan]
  • BKE40290 ([gene|A1B9CF581D2D73AC3D2E290E6B86AD63BE0544DE|yycN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCTCCTTCATA, downstream forward: _UP4_TAACGAAAAGGGCCTGATAA
  • BKK40290 ([gene|A1B9CF581D2D73AC3D2E290E6B86AD63BE0544DE|yycN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCTCTCCTTCATA, downstream forward: _UP4_TAACGAAAAGGGCCTGATAA
  • References

    Research papers

  • 14635137