SubtiBank SubtiBank
uxaB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

uxaB

tagaturonate reductase
locus
BSU_12380
pI
5.06
mw
55.19 kDa
protein length
480 aa Sequence Blast
gene length
1443 bp Sequence Blast
function
hexuronate utilization
product
tagaturonate reductase
essential
no
ec
1.1.1.58
synonyms
yjmI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.15|Utilization of hexuronate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,309,880 1,311,322

    The protein

    Catalyzed reaction/ biological activity

  • D-altronate + NAD+ --> keto-D-tagaturonate + NADH (according to UniProt)
  • Protein family

  • mannitol dehydrogenase family (with [protein|4D54898D405EA25A0C74B1F02A492143D49B7B07|MtlD], according to UniProt)
  • Structure

  • [PDB|4IM7] (YdfI from E. coli, aa 1 - 370, 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,9882655], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    genes
    [gene|5A0C29C7E218701727523885D01A48D02266B421|uxaC]-[gene|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|yjmB]-[gene|3AEA5D769B89E676C916FD8934D762B4C9A02AA2|yjmC]-[gene|CC55984E31C5698668CCCD4AC6E2210B2B41ACAB|yjmD]-[gene|A0A6D36BEC397345A1D17E6A7C34E1F612FD46C7|uxuA]-[gene|B886E504A767343042DE9BF4E23E6798D124A2CF|yjmF]-[gene|6D08E897DD697523FD0720704A25AD4472075B6C|exuT]-[gene|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|exuR]-[gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]-[gene|ED29D2DE48AADEA09C90F08B6021555C357946B4|uxaA]
    description
    [Pubmed|9882655]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9882655], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR]: repression, in the absence of inducer, in [regulon|69B143987DCF73B5D080E3FD87A6CA2940E07DA8|ExuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|9882655] [pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|search|ExuR]) [Pubmed|9882655]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A373 (yjmI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/373 NBRP B. subtilis, Japan]
  • BKE12380 ([gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTTATTGCCTCCCTCT, downstream forward: _UP4_TGCATACAAGGGGGAGAGGT
  • BKK12380 ([gene|A1C64447E0074B06C9210CC51680273FAAE703FA|uxaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTTATTGCCTCCCTCT, downstream forward: _UP4_TGCATACAAGGGGGAGAGGT
  • References

  • 9579062,9579062,9882655,10666464