SubtiBank SubtiBank
yoaV
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yoaV

putative cysteine and O-acetyl serine efflux permease
locus
BSU_18770
pI
9.43
mw
32.89 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
unknown
product
putative cysteine and O-acetyl serine efflux permease
essential
no
synonyms
cyeA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.4|Putative amino acid transporter]
  • Gene

    Coordinates
    2,045,929 2,046,807

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 13-137, aa 159-285) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]-[gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]-[gene|694BC1E02DBAC48CC2BEEFCADED7889BC18E363C|yoaT]-[gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B401 (yoaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1400 NBRP B. subtilis, Japan]
  • BKE18770 ([gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGAAGCCGCCTTTCT, downstream forward: _UP4_TGAATGATATACATTTCCCC
  • BKK18770 ([gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGAAGCCGCCTTTCT, downstream forward: _UP4_TGAATGATATACATTTCCCC