SubtiBank SubtiBank
spoIVA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

spoIVA

ATPase, spore coat morphogenetic protein, anchors the spore coat to the spore surface via SpoVM
locus
BSU22800
pI
4.55
mw
55.01 kDa
protein length
492 aa Sequence Blast
gene length
1476 bp Sequence Blast
function
spore cortex formation and coat assembly
product
ATPase, basement layer protein for spore coat assembly
essential
no
synonyms
spoVP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.1|Class I]
  • Gene

    Coordinates
    2,386,195 → 2,387,673

    Phenotypes of a mutant

  • the spore coat does not localize to the spore surface but self-assembles into aggregates in the mother cell cytoplasm [Pubmed|22171814]
  • The protein

    Catalyzed reaction/ biological activity

  • uses ATP hydrolysis to drive self-assembly into static filaments [Pubmed|23267091]
  • ATP hydrolysis drives polymerization of a nucleotide-free filament [Pubmed|23267091]
  • ploymerization depends on a critical threshold concentration of SpoIVA that is only achieved once the protein is recruited to the surface of the developing spore [Pubmed|23267091]
  • [SW|Domains]

  • contains a Walker A ATPase domain
  • [SW|Localization]

  • innermost protein of the spore coat basement [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]
    description
    [Pubmed|1729246]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|1729246,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|1729246,15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE22800 (Δ[gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • BKK22800 (Δ[gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • References

    Reviews

  • 22192522,23202530,26418292,28408070
  • Original publications

  • 8748030,15699190,1729246,8936302,1729247,9922240,7592342,8299942,1691789,12644503,18691972,17427285,19775244,22171814,15383836,23267091,19702880,22262582,24810258,25854653,26387458