SubtiBank SubtiBank
ydeE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeE

similar to transcription factor (AraC family)
locus
BSU_05170
pI
7.22
mw
33.10 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    563,614 564,486

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-C081 (ydeE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2079 NBRP B. subtilis, Japan]
  • BKE05170 ([gene|A26310839513EE348585D57E623CD5213B5C768B|ydeE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTTGGCCTCCTTTA, downstream forward: _UP4_TAATACGTTTTTCAATCAGA
  • BKK05170 ([gene|A26310839513EE348585D57E623CD5213B5C768B|ydeE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTTGGCCTCCTTTA, downstream forward: _UP4_TAATACGTTTTTCAATCAGA
  • References

  • 23504016