SubtiBank SubtiBank
ykuJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykuJ

unknown
locus
BSU_14100
pI
4.34
mw
9.11 kDa
protein length
gene length
240 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,484,117 1,484,356

    The protein

    Structure

  • [PDB|2FFG]
  • Expression and Regulation

    Operons

    genes
    [gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]
    description
    [Pubmed|16395550]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]~P [Pubmed|18840696,14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A771 (ykuJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/771 NBRP B. subtilis, Japan]
  • GP214 (deletion of ''[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]'', replaced by ''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT, downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
  • BKK14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT, downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
  • lacZ fusion

  • pGP710 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab, pGP714 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16395550