SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Carbon-flux regulating HPr, formerly known as Catabolite repression HPr-like protein, control of flux through the harmful methylglyoxal pathway, minor cofactor of the [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] transcription factor
9.19 kDa
protein length
gene length
258 bp Sequence Blast
control of carbon flux
carbon-flux regulating HPr

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,569,292 3,569,549

    The protein

    Protein family

  • HPr family (with [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH], according to UniProt)
  • Paralogous protein(s)

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH]
  • [SW|Domains]

  • Hpr domain (aa 1-85) (according to UniProt)
  • Modification

  • phosphorylation on Ser46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] [Pubmed|9237995,21992469,22092971]
  • Structure

  • [PDB|2AK7] (dimeric Crh-Ser46-P) [pubmed|16411239]
  • [PDB|1ZVV] ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]-Crh-DNA complex)
  • [PDB|2RLZ] (dimer)
  • [PDB|1MU4]
  • Additional information

  • Crh does not possess the phosphorylation site used for [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] phosphotransfer (His-15 in [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH]), it can only be phosphorylated on Ser-46
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • GP860 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::aphA3) [Pubmed|21992469], available in [SW|Jörg Stülke]'s lab
  • QB7097 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
  • BKK34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
  • Expression vectors

  • pGP641 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP734 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • see [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]
  • two-hybrid system

  • [gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh], crh(Ser46Asp), crh(Ser46Ala) B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Anne Galinier], University of Marseille, France
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • References

  • 12972249,9973552,9237995,16272399,15126459,10217795,17142398,16316990,12009882,10589728,12670692,11916384,11361076,11361074,18320329,18284240,16411239,21992469,22092971,29514981