SubtiBank SubtiBank
mobB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mobB

molybdopterin-guanine dinucleotide biosynthesis
locus
BSU_14290
pI
5.76
mw
19.00 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
function
nitrate respiration
product
molybdenum cofactor synthesis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,498,445 1,498,966

    The protein

    Protein family

  • MobB family (single member, according to UniProt)
  • Structure

  • [PDB|4OYH]
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14290 ([gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTCCCGCTGTTTTGAA, downstream forward: _UP4_CAGCTGAAGGGGGAATCTGC
  • BKK14290 ([gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTCCCGCTGTTTTGAA, downstream forward: _UP4_CAGCTGAAGGGGGAATCTGC
  • References

    Reviews

  • 23539623
  • Original publications

  • 22383849