SubtiBank SubtiBank
ktrB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ktrB

high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], integral membrane subunit
locus
BSU_31100
pI
10.12
mw
48.27 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
function
potassium uptake
product
high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], integral membrane subunit
essential
no
synonyms
yubG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,189,089 3,190,426

    Phenotypes of a mutant

  • a [gene|search|kimA ][gene|search|ktrA ][gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of potassium
  • Protein family

  • TrkH potassium transport family (with [protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], according to UniProt)
  • Paralogous protein(s)

  • [protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD]
  • Kinetic information

  • the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] channel has a high affinity for potassium,this is determined by [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] [pubmed|30753894]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex) [Pubmed|23598340]
  • [SW|Localization]

  • integral membrane protein [Pubmed|12562800]
  • Expression and Regulation

    Operons

    genes
    [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]
    description
    [Pubmed|12562800]

    regulatory mechanism

  • [regulon|ydaO riboswitch|ydaO riboswitch]: termination/antitermination, expression is switched off upon binding of c-di-AMP, in [regulon|ydaO riboswitch|ydaO riboswitch]
  • view in new tab

    additional information

  • growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] expression [pubmed|28679749]
  • Biological materials

    Mutant

  • MGNA-A227 (yubG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/227 NBRP B. subtilis, Japan]
  • 1A954 ( ''ktrB''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
  • GHB1 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Erhard Bremer]'s lab
  • GP92 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2498 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc'' [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE31100 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT, downstream forward: _UP4_TGATATCAAAAAAATCCGGC
  • BKK31100 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT, downstream forward: _UP4_TGATATCAAAAAAATCCGGC
  • GP2716 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP3064 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''kan''), available in [SW|Jörg Stülke]'s lab
  • Expression vector

  • pGP2992: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2277 (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
  • [SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
  • [SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
  • References

    Reviews

  • 25869574,21680052,27935846,25838295,28825218
  • Original publications

  • 12562800,20511502,17932047,23086297,23598340,16990138,24141192,26771197,28420751,28504641,28679749,30753894,31624134,32253343