SubtiBank SubtiBank
ktrB
The papers of the month are back! Check them out! Link here

ktrB

high affinity potassium transporter [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], integral membrane subunit
locus
BSU31100
pI
10.12
mw
48.27 kDa
protein length
445 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
potassium uptake
product
high affinity potassium transporter [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], integral membrane subunit
essential
no
synonyms
yubG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,189,089 → 3,190,426

    Phenotypes of a mutant

  • a [gene|search|kimA ][gene|search|ktrA ][gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
  • The protein

    Paralogous protein(s)

  • [protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex) [Pubmed|23598340]
  • [SW|Localization]

  • integral membrane protein [Pubmed|12562800]
  • Expression and Regulation

    Operons

    genes
    [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]
    description
    [Pubmed|12562800]

    regulatory mechanism

  • [regulon|ydaO riboswitch|ydaO riboswitch]: termination/antitermination, expression is switched off upon binding of c-di-AMP, in [regulon|ydaO riboswitch|ydaO riboswitch]
  • view in new tab

    additional information

  • growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] expression [pubmed|28679749]
  • Biological materials

    Mutant

  • MGNA-A227 (yubG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/227 NBRP B. subtilis, Japan]
  • 1A954 ( ''ktrB''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
  • GHB1 (Δ[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Erhard Bremer]'s lab
  • GP92 (Δ[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2083 (Δ[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' Δ[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BKE31100 (Δ[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT, downstream forward: _UP4_TGATATCAAAAAAATCCGGC
  • BKK31100 (Δ[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT, downstream forward: _UP4_TGATATCAAAAAAATCCGGC
  • GP2716 (Δ[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc''), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2277 (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 25869574,21680052,27935846,25838295,28825218
  • Original publications

  • 12562800,20511502,17932047,23086297,23598340,16990138,24141192,26771197,28420751,28504641,28679749