SubtiBank SubtiBank
bofC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bofC

general stress protein, controls processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB]
locus
BSU_27750
pI
5.75
mw
19.15 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
control of processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB]
product
forespore regulator of the [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] checkpoint
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    2,836,909 2,837,421

    The protein

    Structure

  • [PDB|2BW2]
  • Expression and Regulation

    Operons

    genes
    [gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]-[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]
    description
    [Pubmed|9099855]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,9099855], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|9099855], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,9099855], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|16497325,9099855]
  • view in new tab

    Biological materials

    Mutant

  • BKE27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC, downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
  • BKK27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC, downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
  • References

    Reviews

  • 31350897
  • Original Publications

  • 16497325,10931291,16049010,9025289,11544224,9099855