SubtiBank SubtiBank
dgcW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dgcW

diguanylate cyclase and potential phosphodiesterase
locus
BSU_13420
pI
6.82
mw
84.63 kDa
protein length
749 aa Sequence Blast
gene length
2250 bp Sequence Blast
function
synthesis of c-di-GMP
product
diguanylate cyclase and potential phosphodiesterase
essential
no
synonyms
ykoW

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,407,329 1,409,578

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
  • [SW|Domains]

  • MHYT domain (aa 7-201) (according to UniProt)
  • contains a N-terminal [SW|PAS domain] [Pubmed|23893111]
  • contains a central [SW|GGDEF domain] and a C-terminal [SW|EAL domain] [Pubmed|22821967]
  • aa 290-735 are similar to ''E. coli'' CsrD (18% identity, 43% similarity)
  • Structure

  • [PDB|5XGB] (from Pseudomonas aeruginosa, corresponds to the C-terminal part of DgcW, aa 194 ... 735, 29% identity) [pubmed|29109186]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B314 (ykoW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1313 NBRP B. subtilis, Japan]
  • GP850 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BP140 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''ermC'') available in [SW|Fabian Commichau]'s lab
  • BP142 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BKE13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
  • BKK13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 11728710,16980588,22821967,22383849,23893111,26577401,29109186