SubtiBank SubtiBank
pucM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucM

uricase
locus
BSU_32460
pI
5.08
mw
13.27 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast
function
purine utilization
product
uricase
essential
no
ec
3.5.2.17
synonyms
yunM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,334,646 3,334,990

    The protein

    Catalyzed reaction/ biological activity

  • 5-hydroxyisourate + H2O --> 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate + H+ (according to UniProt)
  • Protein family

  • transthyretin family (according to UniProt)
  • Structure

  • [PDB|2H0E] [Pubmed|16782815]
  • Expression and Regulation

    Operons

    genes
    [gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]-[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A938 (yunM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/938 NBRP B. subtilis, Japan]
  • BKE32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
  • BKK32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
  • References

  • 11344136,12823818,12029039,16782815,20168977,25755103