SubtiBank SubtiBank
yvbT

yvbT

similar to alkanal monooxygenase
locus
BSU_33980
pI
5.32
mw
36.94 kDa
protein length
336 aa Sequence Blast
gene length
1011 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,486,807 3,487,817

    The protein

    Protein family

  • Flavin-utilizing monoxygenases
  • Paralogous protein(s)

  • [protein|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|CmoO], [protein|40654E556CC97A4E47FC757F93F29BEACD21CC3A|YddN], [protein|A1DCFF8D225C87197104742E72A0D4F238BC30EB|YwcH]
  • [protein|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|YceB]:
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|4US5] (from ''Streptomyces bottropensis'', 36% identity) [Pubmed|24554499]
  • Expression and Regulation

    Operons

    genes
    [gene|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|yvbT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A464 (yvbT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/464 NBRP B. subtilis, Japan]
  • BKE33980 ([gene|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|yvbT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTCTCCTTTGCAA, downstream forward: _UP4_TAACAGCTATAAAAAAAGCA
  • BKK33980 ([gene|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|yvbT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTTCTCCTTTGCAA, downstream forward: _UP4_TAACAGCTATAAAAAAAGCA
  • References

  • 24554499