SubtiBank SubtiBank
citG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

citG

fumarase
locus
BSU_33040
pI
5.47
mw
50.36 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
TCA cycle
product
fumarate hydratase
essential
no
ec
4.2.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • Gene

    Coordinates
    3,389,024 3,390,412

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate --> fumarate + H2O (according to UniProt)
  • Protein family

  • class-II fumarase/aspartase family (with [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|AnsB], according to UniProt)
  • Paralogous protein(s)

  • [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|AnsB]
  • Structure

  • [PDB|1FUO] (from ''E. coli'', 64% identity) [Pubmed|8909293]
  • [SW|Localization]

  • forms discrete foci in the cytoplasm [pubmed|29140245]
  • colocalizes with DNA upon DNA damage (MMS treatment) [pubmed|29140245]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
    description
    [Pubmed|3923430]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3130545,2509422,2509423], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|3130545,2509422], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • constitutive
  • view in new tab

    genes
    [gene|B66AE23754A9CD4D5BCFC75CE6918522C7A22DA6|yvzF]-[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the protein amounts increase upon DNA damage (MMS treatment) [pubmed|29140245]
  • Biological materials

    Mutant

  • GP718 (spec), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • GP2340 Δ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2341 Δ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
  • BKK33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
  • Expression vectors

  • pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • lacZ fusion

  • pGP387 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Jörg Stülke] lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • **
  • References

  • 2509422,3923430,3130545,2509423,20933603,15378759,6098632,8909293,29140245