SubtiBank SubtiBank
kbaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

kbaA

activation of the [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent pathway to [SW|sporulation], control of the [SW|phosphorelay]
locus
BSU_01560
pI
9.81
mw
22.63 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
control of [SW|sporulation ]initiation
product
effector of [protein|search|KinB ]activity
essential
no
synonyms
ybxC,ybaM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    159,182 159,778

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT, downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
  • BKK01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT, downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
  • References

  • 12884008,8576055,23199363,29314743