SubtiBank SubtiBank
kbaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

kbaA

activation of the [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]-dependent pathway to [SW|sporulation], control of the [SW|phosphorelay]
locus
BSU_01560
pI
9.81
mw
22.63 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
control of [SW|sporulation ]initiation
product
effector of [protein|search|KinB ]activity
essential
no
synonyms
ybxC,ybaM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    159,182 159,778

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT, downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
  • BKK01560 ([gene|A3D19A75C5B9A744E6AED40931B5E71157AD48BC|kbaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTATTCATCCCCT, downstream forward: _UP4_CTGCCGAAGTTTGCAGCAAA
  • References

  • 12884008,8576055,23199363,29314743