SubtiBank SubtiBank


putative formate dehydrogenase
108.57 kDa
protein length
980 aa Sequence Blast
gene length
2943 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,781,209 2,784,151

    The protein

    Catalyzed reaction/ biological activity

  • formate + NAD+ --> CO2 + NADH (according to UniProt)
  • Protein family

  • C-terminal part: [SW|prokaryotic molybdopterin-containing oxidoreductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E54F39E72DC4881E886159607C2B424A41DE0D01|YjgC]
  • [SW|Domains]

  • 2Fe-2S ferredoxin-type domain (aa 5-81) (according to UniProt)
  • 4Fe-4S His(Cys)3-ligated-type domain (aa 81-121) (according to UniProt)
  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 144-171, aa 187-216) (according to UniProt)
  • [SW|4Fe-4S Mo/W bis-MGD-type domain] (aa 263-319) (according to UniProt)
  • Modification

  • Fe-S cluster [pubmed|29292548]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|2FUG] (from Thermus thermophilus, 23% identity) [pubmed|16469879]
  • Additional information

  • The gene is annotated in KEGG as an ortholog of formate dehydrogenase EC In Swiss-Prot the protein is named formate dehydrogenase chain A. In MetaCyc the protein is characterized as similar to formate dehydrogenase. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation



    additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yrhE'' [Pubmed|27120414]
  • view in new tab

    Biological materials


  • MGNA-A160 (yrhE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27220 ([gene|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|yrhE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATATTCCCCTCCA, downstream forward: _UP4_GATTAAACGATAGGAGGAAA
  • BKK27220 ([gene|A4304213CFC152B601B2EED2B9B3A0A3AB4E6A81|yrhE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATATTCCCCTCCA, downstream forward: _UP4_GATTAAACGATAGGAGGAAA
  • References

  • 21815947,27120414,19935659,16469879