SubtiBank SubtiBank
yutF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yutF

p-nitrophenyl phosphatase
locus
BSU_32290
pI
4.55
mw
27.81 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
unknown
product
p-nitrophenyl phosphatase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,318,029 3,318,799

    The protein

    Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • Structure

  • [PDB|3PDW]
  • Expression and Regulation

    Operons

    genes
    [gene|527956DFAF0BE1115E6FDC82B03527D0BA96D56F|yutD]-[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]-[gene|A44198B11130B97406FD360A287A945AF9200CE9|yutF]
    description
    [Pubmed|27907199]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A974 (yutF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/974 NBRP B. subtilis, Japan]
  • BKE32290 ([gene|A44198B11130B97406FD360A287A945AF9200CE9|yutF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAACACTCCTGTGG, downstream forward: _UP4_TGAAAAAAGGGCGCCCTAAA
  • BKK32290 ([gene|A44198B11130B97406FD360A287A945AF9200CE9|yutF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAACACTCCTGTGG, downstream forward: _UP4_TGAAAAAAGGGCGCCCTAAA
  • References

  • 24256105,27784292,27907199