SubtiBank SubtiBank
yugS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yugS

spore membrane protein, similar to magnesium exporter
locus
BSU_31300
pI
5.13
mw
49.33 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.1|Magnesium uptake/ efflux]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,216,163 3,217,452

    The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|YhdP], [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|YqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA]
  • [SW|Domains]

  • [SW|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
  • [SW|DUF21 domain] (4-201)
  • 2 [SW|CBS domain]s (aa 220-281, aa 284-341) (according to UniProt)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane [pubmed|30602489]
  • Expression and Regulation

    Operons

    genes
    [gene|A459410312A926365B45CEB4694DE399B38820A2|yugS]
    description
    [Pubmed|9274030]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A632 (yugS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/632 NBRP B. subtilis, Japan]
  • BKE31300 ([gene|A459410312A926365B45CEB4694DE399B38820A2|yugS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAAGCCCTTACCATA, downstream forward: _UP4_TGATAAAAAACAGCCGGGGA
  • BKK31300 ([gene|A459410312A926365B45CEB4694DE399B38820A2|yugS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAAGCCCTTACCATA, downstream forward: _UP4_TGATAAAAAACAGCCGGGGA
  • Expression vectors

  • pGP2936 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 9274030,27933050,30602489,31415562