SubtiBank SubtiBank
natK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

natK

two-component sensor kinase, regulation of the [gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB] operon
locus
BSU_02730
pI
8.05
mw
34.92 kDa
protein length
318 aa Sequence Blast
gene length
957 bp Sequence Blast
function
regulation of the [gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB] operon
product
two-component sensor kinase
essential
no
synonyms
yccG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    294,615 295,571

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|D3F6337B94A633730E514B05CA852BE9AA3741B3|NatR] in response to sodium availability
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • three transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D3F6337B94A633730E514B05CA852BE9AA3741B3|natR]-[gene|A4644CB18F7D0DF3E7E50ABB0C0F224D5744A1A5|natK]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C042 (yccG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2040 NBRP B. subtilis, Japan]
  • BKE02730 ([gene|A4644CB18F7D0DF3E7E50ABB0C0F224D5744A1A5|natK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGGGTAATCACGTACTAAA, downstream forward: _UP4_TAAAAAAACCTTGAAAAGCC
  • BKK02730 ([gene|A4644CB18F7D0DF3E7E50ABB0C0F224D5744A1A5|natK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGGGTAATCACGTACTAAA, downstream forward: _UP4_TAAAAAAACCTTGAAAAGCC
  • References

  • 10094672,17322186