SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


sulfite reductase (NADPH2) (beta subunit)
64.63 kDa
protein length
571 aa Sequence Blast
gene length
1716 bp Sequence Blast
sulfite reduction
sulfite reductase (NADPH2)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    3,430,598 3,432,313

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • The protein

    Catalyzed reaction/ biological activity

  • 3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
  • Protein family

  • nitrite and sulfite reductase 4Fe-4S domain family (with [protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|NasD], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • heme [pubmed|29852252]
  • Structure

  • [PDB|6C3M] (from E. coli, 52% identity) [pubmed|29852252]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: activation, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials


  • MGNA-B602 (yvgR::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A802 ( ''cysI''::''kan''), [Pubmed|11445163], available at [ BGSC]
  • 1A934 ( ''cysI''::''kan''), [Pubmed|12169591], available at [ BGSC]
  • BKE33430 (''[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • BKK33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • References

  • 12169591,12107147,11445163,29852252