SubtiBank SubtiBank


sulfite reductase (NADPH2) (beta subunit)
64.63 kDa
protein length
571 aa Sequence Blast
gene length
1716 bp Sequence Blast
sulfite reduction
sulfite reductase (NADPH2)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    3,430,598 3,432,313

    Phenotypes of a mutant

  • unable to grow with sulfate or sulfite as the only sulfur source [Pubmed|12169591]
  • The protein

    Catalyzed reaction/ biological activity

  • 3 H2O + hydrogen sulfide + 3 NADP+ --> 4 H+ + 3 NADPH + sulfite (according to UniProt)
  • Protein family

  • nitrite and sulfite reductase 4Fe-4S domain family (with [protein|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|NasD], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • heme [pubmed|29852252]
  • Structure

  • [PDB|6C3M] (from E. coli, 52% identity) [pubmed|29852252]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12169591], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL]: activation, [Pubmed|12169591], in [regulon|FB37E9B7F7727915ADB18E52FD07A8773C7B30FC|CysL regulon]
  • regulation

  • induced by sulfite, sulfate, and thiosulfate ([protein|search|CysL]) [Pubmed|12169591]
  • view in new tab

    Biological materials


  • MGNA-B602 (yvgR::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A802 ( ''cysI''::''kan''), [Pubmed|11445163], available at [ BGSC]
  • 1A934 ( ''cysI''::''kan''), [Pubmed|12169591], available at [ BGSC]
  • BKE33430 (''[gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • BKK33430 ([gene|A4C9E4D1163B703A917BFCF97A5F575B19EDDD8D|cysI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC, downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
  • References

  • 12169591,12107147,11445163,29852252