SubtiBank SubtiBank
lplA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lplA

lipoprotein, putative [SW|ABC transporter] (solute binding protein)
locus
BSU_07100
pI
5.61
mw
56.05 kDa
protein length
502 aa Sequence Blast
gene length
1509 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    779,529 781,037

    The protein

    Paralogous protein(s)

  • [protein|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|YtcQ]
  • [SW|Localization]

  • associated to the membrane (via [protein|AA19541BCCAE08B48BD23F4E8337EBA220E5C4EF|LplB]-[protein|0A7FF3E2747598AE0EE39183E8827879C4B11A80|LplC]) [Pubmed|10092453]
  • Biological materials

    Mutant

  • BKE07100 ([gene|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|lplA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCGTAAGTCCCCCT, downstream forward: _UP4_TAAACCGATGCGCCTGCCTT
  • BKK07100 ([gene|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|lplA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCGTAAGTCCCCCT, downstream forward: _UP4_TAAACCGATGCGCCTGCCTT
  • References

  • 7921237,10092453