SubtiBank SubtiBank
ytcB
The papers of the month are back! Check them out! Link here

ytcB

putative UDP-glucose epimerase
locus
BSU30870
pI
8.87
mw
34.76 kDa
protein length
316 aa Sequence Blast
gene length
948 bp Sequence Blast
function
unknown
product
putative UDP-glucose epimerase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,157,008 → 3,157,958

    The protein

    Protein family

  • sugar epimerase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|YfnG]:
  • Structure

  • [PDB|1SB8] (Pseudomonas aeruginosa UDP-N-acetylglucosamine 4-epimerase, 34% identity) [Pubmed|15016816], [PDB|5U4Q] (from Klebsiella pneumoniae 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|59024C05AA0106719C81E45E3B060A6F710B2690|ytcA]-[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]-[gene|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|ytcC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|22383849,15699190,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC], [SW|GerE]) [Pubmed|26577401,15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A279 (ytcB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/279 NBRP B. subtilis, Japan]
  • BKE30870 (Δ[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGCTCCTGTGACGAGTA, downstream forward: _UP4_TCGCTGTATCAGGGGGAATA
  • BKK30870 (Δ[gene|A51B5F9F86D2F7B690712B9EC181B1C07B312E02|ytcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTGCTCCTGTGACGAGTA, downstream forward: _UP4_TCGCTGTATCAGGGGGAATA
  • References

  • 22383849,26577401,15016816