SubtiBank SubtiBank
hemL

hemL

glutamate-1-semialdehyde aminotransferase
locus
BSU_28120
pI
5.05
mw
46.29 kDa
protein length
430 aa Sequence Blast
gene length
1290 bp Sequence Blast
function
heme biosynthesis
product
glutamate-1-semialdehyde aminotransferase
essential
no
ec
5.4.3.8
synonyms
hemK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    2,872,880 → 2,874,172

    The protein

    Catalyzed reaction/ biological activity

  • (S)-4-amino-5-oxopentanoate --> 5-aminolevulinate (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8BB8EECA8ECFA1CC6D46E81250905DBC6D2C503E|GsaB]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3BS8] [Pubmed|20946885]
  • Expression and Regulation

    Operons

    count
    2
    genes
    [gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
    description
    [Pubmed|1672867]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE28120 (Δ[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCAACTCCTGTC, downstream forward: _UP4_TAAGAGTGAAAACCGGTATC
  • BKK28120 (Δ[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGCCTCAACTCCTGTC, downstream forward: _UP4_TAAGAGTGAAAACCGGTATC
  • References

    Reviews

  • 28123057
  • Original Publications

  • 10217486,1672867,20946885,11532148