SubtiBank SubtiBank
araR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

araR

transcriptional repressor ([SW|GntR family], [SW|LacI family]) of the arabinose utilization genes
locus
BSU_33970
pI
6.34
mw
43.00 kDa
protein length
384 aa Sequence Blast
gene length
1155 bp Sequence Blast
function
regulation of arabinose utilization
product
transcriptional repressor ([SW|GntR family], [SW|LacI family])
essential
no
synonyms
araC,yvbS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.6|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,485,604 3,486,758

    Phenotypes of a mutant

  • inactivation of ''[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]'' reduces sporulation efficiency to 28% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|GntR family]: N-terminal DNA-binding domain, [SW|LacI family]: C-terminal effector-binding domain
  • [SW|Domains]

  • N-terminal DNA-binding domain ([SW|GntR family])
  • C-terminal effector-binding domain ([SW|LacI family])
  • Structure

  • [PDB|3TB6] (effector-binding domain) [Pubmed|22281747]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000020 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]
    description
    [Pubmed|9045819]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9401028], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
  • view in new tab

    Biological materials

    Mutant

  • BKE33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT, downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
  • BKK33970 ([gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT, downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
  • References

  • 17617643,3131313,16585763,10417639,11418559,14973026,9045819,23109551,25364981,22281747,26151451,26511320,26735940