SubtiBank SubtiBank
araR
The papers of the month are back! Check them out! Link here

araR

transcriptional repressor ([SW|GntR family], [SW|LacI family]) of the arabinose utilization genes
locus
BSU33970
pI
6.34
mw
43.00 kDa
protein length
384 aa Sequence Blast
gene length
1152 bp Sequence Blast
function
regulation of arabinose utilization
product
transcriptional repressor ([SW|GntR family], [SW|LacI family])
essential
no
synonyms
araC,yvbS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.6|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,485,604 → 3,486,758

    Phenotypes of a mutant

  • inactivation of ''[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]'' reduces sporulation efficiency to 28% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|GntR family]: N-terminal DNA-binding domain, [SW|LacI family]: C-terminal effector-binding domain
  • [SW|Domains]

  • N-terminal DNA-binding domain ([SW|GntR family])
  • C-terminal effector-binding domain ([SW|LacI family])
  • Structure

  • [PDB|3TB6] (effector-binding domain) [Pubmed|22281747]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000020 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]
    description
    [Pubmed|9045819]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9401028], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|10417639]
  • view in new tab

    Biological materials

    Mutant

  • BKE33970 (Δ[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT, downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
  • BKK33970 (Δ[gene|A567466894AE9DE7CDE7816615433A37532297B5|araR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCTCCAAAAT, downstream forward: _UP4_TAAAAAAAGCAATGTATGGG
  • References

  • 17617643,3131313,16585763,10417639,11418559,14973026,9045819,23109551,25364981,22281747,26151451,26511320,26735940