SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glucan 1,4-alpha-maltohydrolase, neopullulanase, maltogenic amylase
68.68 kDa
protein length
589 aa Sequence Blast
gene length
1770 bp Sequence Blast
starch and maltodextrin utilization
glucan 1,4-alpha-maltohydrolase, neopullulanase, maltogenic amylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,555,902 3,557,671

    The protein

    Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Structure

  • [PDB|1J0J] (from G. stearothermophilus, 56% identity, complex with maltotetraose), [PDB|1J0H] (from G. stearothermophilus, 56% identity)
  • [SW|Localization]

  • on both sides of the cytoplasmic membrane and in the periplasm during vegetative growth but in the cytoplasm of prespores [Pubmed|19465663]
  • Expression and Regulation




  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials


  • MGNA-B628 (yvdF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34620 ([gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCCTTTGATTT, downstream forward: _UP4_TAACATTCTGTTATCGGTAA
  • BKK34620 ([gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCCCCCTTTGATTT, downstream forward: _UP4_TAACATTCTGTTATCGGTAA
  • References

  • 16707683,19465663,15650689