SubtiBank SubtiBank
tatCD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tatCD

component of the [protein|E4395255CD43ACB611E0BA872182DF801662C366|TatAD]-[protein|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|TatCD] twin-arginine translocase
locus
BSU_02640
pI
9.34
mw
27.96 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
function
TAT [SW|protein secretion]
product
component of the twin-arginine translocation pathway
essential
no
synonyms
ycbT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    286,048 286,776

    The protein

    Catalyzed reaction/ biological activity

  • translocation of [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|PhoD] [Pubmed|19395490]
  • Protein family

  • tatC family (with [protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY], according to UniProt)
  • Paralogous protein(s)

  • [protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]
  • Structure

  • [PDB|4B4A] (from Aquifex aeolicus, 32% identity) [pubmed|23201679]
  • [SW|Localization]

  • cell membrane [Pubmed|19616508]
  • Expression and Regulation

    Operons

    genes
    [gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10094677], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10094677,11007775], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|10094677]
  • additional information

  • expression of the operon depends on functional [protein|search|HemAT] and [protein|search|CsbC] [PubMed|23180473]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C038 (ycbT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2036 NBRP B. subtilis, Japan]
  • BKE02640 ([gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAAAAAGCCCTCCCT, downstream forward: _UP4_AGGGAAGAAACAGCGGCGGC
  • BKK02640 ([gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAAAAAGCCCTCCCT, downstream forward: _UP4_AGGGAAGAAACAGCGGCGGC
  • labs

  • [SW|Jan Maarten van Dijl], University of Groningen, The Netherlands, [https://www.rug.nl/staff/j.m.van.dijl/ Homepage]
  • References

    Reviews

  • 22683878,24140208,25975269,25494301,27121927,31401776
  • Original publications

  • 11007775,15554971,22544248,11007775,19383693,19395490,19616508,22383849,10094677,23180473,24236045,27984091,23201679