SubtiBank SubtiBank
yvnA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvnA

unknown
locus
BSU_35050
pI
10.06
mw
18.10 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,602,074 3,602,547

    The protein

    [SW|Domains]

  • [SW|HTH marR-type domain] (aa 6-157) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A58CB284AC04FBFD1EEF6D8DC1BB37E095E2B4FC|yvnA]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (7-fold) ([protein|search|CcpA]) [Pubmed|12850135], subject to carbon catabolite repression (7-fold: [protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A334 (yvnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/334 NBRP B. subtilis, Japan]
  • BKE35050 ([gene|A58CB284AC04FBFD1EEF6D8DC1BB37E095E2B4FC|yvnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTGCCTCTCTGAT, downstream forward: _UP4_TAAAAAGAGTCTCACCCGCA
  • BKK35050 ([gene|A58CB284AC04FBFD1EEF6D8DC1BB37E095E2B4FC|yvnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTTGCCTCTCTGAT, downstream forward: _UP4_TAAAAAGAGTCTCACCCGCA
  • References

  • 12850135,20817675