SubtiBank SubtiBank
pyrP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pyrP

uracil permease
locus
BSU_15480
pI
9.50
mw
45.41 kDa
protein length
435 aa Sequence Blast
gene length
1308 bp Sequence Blast
function
uracil transport in/out via proton symport
product
uracil permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,619,023 1,620,330

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • Structure

  • [PDB|3QE7] (E. coli uracil transporter, 43% identity) [pubmed|21423164]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15480 ([gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCCCCCTGAT, downstream forward: _UP4_ACATCTGAACAACATCATAT
  • BKK15480 ([gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCCCCCTGAT, downstream forward: _UP4_ACATCTGAACAACATCATAT
  • References

  • 7868607,8206849,12896995,16133632,1709162,17322189,18763711,21423164