SubtiBank SubtiBank
nagZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nagZ

N-acetylglucosaminidase
locus
BSU_01660
pI
9.76
mw
70.40 kDa
protein length
642 aa Sequence Blast
gene length
1929 bp Sequence Blast
function
cell wall recycling
product
N-acetylglucosaminidase
essential
no
ec
3.2.1.52
synonyms
yzbA,ybbD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • Gene

    Coordinates
    186,452 188,380

    Phenotypes of a mutant

  • increased autolysis [Pubmed|20400549]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves muropeptides derived from peptidoglycan, but not peptidoglycan itself [Pubmed|20400549]
  • Hydrolysis of terminal non-reducing N-acetyl-D-hexosamine residues in N-acetyl-beta-D-hexosaminides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 3 family (single member, according to UniProt)
  • Structure

  • [PDB|3BMX] [Pubmed|20826810]
  • [SW|Localization]

  • secreted (with signal peptide), remains to some extent cell wall-associated [Pubmed|20400549]
  • Additional information

  • The gene is mis-annotated in KEGG as an ortholog of beta-N-acetylhexosaminidase EC 3.2.1.52. It is marked in MetaCyc as similar to beta-hexosaminidase. No EC annotation is available in Swiss-ProtSwiss-Prot.supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]-[gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]-[gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]-[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]-[gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]-[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Christoph Mayer]'s lab [Pubmed|20400549]
  • BKE01660 ([gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAACTTCCTCCTATC, downstream forward: _UP4_AGACCGCTTTAATAAGGAGG
  • BKK01660 ([gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAAACTTCCTCCTATC, downstream forward: _UP4_AGACCGCTTTAATAAGGAGG
  • References

  • 10627040,20400549,4628806,4196675,22383849,26963691,30038046,30673842,30978418