SubtiBank SubtiBank
yozU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozU

unknown, putative pseudogene
locus
BSU_18819
pI
0.00
mw
0.00 kDa
protein length
gene length
213 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,050,373 2,050,585

    Biological materials

    Mutant

  • BKE18819 ([gene|A5E4925583E6C6019724DC33032C15B68B191226|yozU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18819 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCGAGATTTTTA, downstream forward: _UP4_TAGATGGGTTGGGTGATATC
  • BKK18819 ([gene|A5E4925583E6C6019724DC33032C15B68B191226|yozU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18819 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCGAGATTTTTA, downstream forward: _UP4_TAGATGGGTTGGGTGATATC