SubtiBank SubtiBank
ywdE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywdE

unknown
locus
BSU_37990
pI
7.58
mw
19.72 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-55d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,899,272 3,899,805

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B235 (ywdE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1234 NBRP B. subtilis, Japan]
  • BKE37990 ([gene|A5E65408D61B9478ADB45A4C5CA2A878CBFCEAB5|ywdE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACATACACCTCCTTTA, downstream forward: _UP4_TAGTATGCCGTTTCAGTAGG
  • BKK37990 ([gene|A5E65408D61B9478ADB45A4C5CA2A878CBFCEAB5|ywdE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGACATACACCTCCTTTA, downstream forward: _UP4_TAGTATGCCGTTTCAGTAGG